Drop real sequence biology into your Dash app — in one component.
Circular and linear viewers, GenBank / FASTA / NCBI loaders, annotations, primers, 250+ restriction enzymes, motif search, and rich callback state. Built for classrooms and industrial bio-foundries alike.
Drop a real NCBI accession into a Dash app and walk a student through it live. From high-school classrooms to graduate synthetic-biology labs, the same component scales with the lesson.
Biofoundries, ag-biotech, pharma R&D, food & beverage, consumer synbio.
Use dash-seqviz to visualize what ships to a cloning robot or
a production fermenter — without forcing scientists into a heavyweight
desktop tool.
pip install dash-seqviz
conda install -c conda-forge dash-seqviz
from dash import Dash, html
from dash_seqviz import SeqViz
app = Dash(__name__)
app.layout = html.Div([
SeqViz(
id="demo",
name="pUC19 fragment",
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
annotations=[
{"start": 0, "end": 22, "name": "Promoter",
"direction": 1, "color": "#2a9d8f"},
],
enzymes=["EcoRI", "XbaI", "SpeI"],
style={"height": "500px", "width": "100%"},
)
])
if __name__ == "__main__":
app.run(debug=True)
Toggle between circular plasmid maps, linear sequence views, or show both side by side.
Overlay named annotations, directional primers, and highlight regions on any sequence.
250+ NEB enzymes out of the box, plus custom recognition sites.
Fuzzy motif search with configurable mismatch tolerance and searchResults callback.
Full control over base-pair, annotation, translation, and highlight colors.
React to selection, searchResults, and copy events with standard Dash callbacks.